Transcript: Mouse NM_007820.2

Mus musculus cytochrome P450, family 3, subfamily a, polypeptide 16 (Cyp3a16), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cyp3a16 (13114)
Length:
1730
CDS:
84..1598

Additional Resources:

NCBI RefSeq record:
NM_007820.2
NBCI Gene record:
Cyp3a16 (13114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126182 GCGTGGACTTTATTTATCTGA pLKO.1 886 CDS 100% 3.000 4.200 N Cyp3a16 n/a
2 TRCN0000126183 CACCGCGTGGACTTTATTTAT pLKO.1 882 CDS 100% 15.000 10.500 N Cyp3a16 n/a
3 TRCN0000435065 ACCGTGATGGCGATGGAATAC pLKO_005 1131 CDS 100% 10.800 7.560 N Cyp3a16 n/a
4 TRCN0000126181 CTCTAGCTAAAGATGAGGAAT pLKO.1 439 CDS 100% 4.950 3.465 N Cyp3a16 n/a
5 TRCN0000126180 CTGAAATTAAGCAGAGAACTA pLKO.1 1509 CDS 100% 4.950 3.465 N Cyp3a16 n/a
6 TRCN0000437686 GTCCTTGTCAGTAGCACTCTT pLKO_005 740 CDS 100% 4.950 3.465 N Cyp3a16 n/a
7 TRCN0000126179 CCTGAATTATTACAAGGGTTT pLKO.1 233 CDS 100% 4.050 2.430 N Cyp3a16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.