Transcript: Mouse NM_007867.4

Mus musculus distal-less homeobox 4 (Dlx4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dlx4 (13394)
Length:
1820
CDS:
321..1043

Additional Resources:

NCBI RefSeq record:
NM_007867.4
NBCI Gene record:
Dlx4 (13394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007867.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271128 GCGTTTCCAGCACACCCAATA pLKO_005 719 CDS 100% 10.800 15.120 N Dlx4 n/a
2 TRCN0000271179 CTTGTGCTTCTCCGCTTTAAA pLKO_005 1524 3UTR 100% 15.000 10.500 N Dlx4 n/a
3 TRCN0000070618 ACTCACCCAAACCCAGGTAAA pLKO.1 782 CDS 100% 10.800 7.560 N Dlx4 n/a
4 TRCN0000070620 CAAACGCTCCAAATATAAGAA pLKO.1 818 CDS 100% 5.625 3.938 N Dlx4 n/a
5 TRCN0000284322 TGGTGCCTCCAACGTTGTCTT pLKO_005 353 CDS 100% 4.950 3.465 N Dlx4 n/a
6 TRCN0000271129 CAAGCCCAGAACCATCTACTC pLKO_005 671 CDS 100% 4.050 2.835 N Dlx4 n/a
7 TRCN0000284321 ACCGCAGCTTCTCCCGATTTG pLKO_005 435 CDS 100% 3.600 2.520 N Dlx4 n/a
8 TRCN0000070619 CGAAGCAGAATCAGAGAAGCT pLKO.1 599 CDS 100% 2.640 1.848 N Dlx4 n/a
9 TRCN0000070622 TGGCTATGACAACAGCCACTT pLKO.1 965 CDS 100% 0.405 0.284 N Dlx4 n/a
10 TRCN0000070621 CCCTGTCGGTAGTGGCTGCTT pLKO.1 391 CDS 100% 0.000 0.000 N Dlx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007867.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.