Transcript: Mouse NM_007873.3

Mus musculus double C2, beta (Doc2b), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Doc2b (13447)
Length:
5068
CDS:
168..1406

Additional Resources:

NCBI RefSeq record:
NM_007873.3
NBCI Gene record:
Doc2b (13447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007873.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368222 GAACGAGACCCTCACTTATTA pLKO_005 746 CDS 100% 15.000 21.000 N Doc2b n/a
2 TRCN0000368771 CTGTCTGGGATTATGACATTG pLKO_005 1228 CDS 100% 10.800 15.120 N Doc2b n/a
3 TRCN0000022740 GAGGACAAATTCCGCCACAAT pLKO.1 822 CDS 100% 4.950 3.960 N Doc2b n/a
4 TRCN0000022742 CCTATCAAGCAGATCTCCGAT pLKO.1 252 CDS 100% 2.640 2.112 N Doc2b n/a
5 TRCN0000378476 TCAAGCAGATCTCCGATTATT pLKO_005 256 CDS 100% 15.000 10.500 N Doc2b n/a
6 TRCN0000368769 ATCTACAGTGAGGACCTATTG pLKO_005 1667 3UTR 100% 10.800 7.560 N Doc2b n/a
7 TRCN0000022743 CCTCAAGTACAGCTCACAGAA pLKO.1 986 CDS 100% 4.950 3.465 N Doc2b n/a
8 TRCN0000022741 GCAAGGCAAATAAGCTCAGAA pLKO.1 691 CDS 100% 4.950 3.465 N Doc2b n/a
9 TRCN0000022739 GCACTGGTTTGACTGCTTGAA pLKO.1 1313 CDS 100% 4.950 3.465 N Doc2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007873.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.