Transcript: Mouse NM_007892.2

Mus musculus E2F transcription factor 5 (E2f5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
E2f5 (13559)
Length:
1763
CDS:
150..1157

Additional Resources:

NCBI RefSeq record:
NM_007892.2
NBCI Gene record:
E2f5 (13559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013816 GCTGGCTGTAATACTAAAGAA pLKO.1 474 CDS 100% 5.625 7.875 N E2F5 n/a
2 TRCN0000086468 GCTCCAGTTCATCCAAACAAA pLKO.1 1433 3UTR 100% 5.625 4.500 N E2f5 n/a
3 TRCN0000231160 AGACATTCACTGCCATATATA pLKO_005 1523 3UTR 100% 15.000 10.500 N E2f5 n/a
4 TRCN0000231158 CTATCCATGTGCTACTTATAA pLKO_005 787 CDS 100% 15.000 10.500 N E2f5 n/a
5 TRCN0000231159 AGTATCTTCAGGATCTATTAG pLKO_005 992 CDS 100% 13.200 9.240 N E2f5 n/a
6 TRCN0000086469 CCTATCCATGTGCTACTTATA pLKO.1 786 CDS 100% 13.200 9.240 N E2f5 n/a
7 TRCN0000231156 TGTAGGTGCTGGCTGTAATAC pLKO_005 467 CDS 100% 13.200 9.240 N E2f5 n/a
8 TRCN0000231157 GAAATTGAAGATCTCGAATTG pLKO_005 525 CDS 100% 10.800 7.560 N E2f5 n/a
9 TRCN0000086471 CCCAGCAGATGACTACAACTT pLKO.1 1076 CDS 100% 4.950 3.465 N E2f5 n/a
10 TRCN0000086472 GCTGAAATTGAAGATCTCGAA pLKO.1 522 CDS 100% 2.640 1.848 N E2f5 n/a
11 TRCN0000086470 GATCTGTTTGATGTTCAGATA pLKO.1 1125 CDS 100% 0.495 0.347 N E2f5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.