Transcript: Mouse NM_007934.3

Mus musculus glutamyl aminopeptidase (Enpep), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Enpep (13809)
Length:
4208
CDS:
269..3106

Additional Resources:

NCBI RefSeq record:
NM_007934.3
NBCI Gene record:
Enpep (13809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031091 GCGCTTCCTAAACTGGATAAA pLKO.1 1268 CDS 100% 13.200 18.480 N Enpep n/a
2 TRCN0000287867 GCGCTTCCTAAACTGGATAAA pLKO_005 1268 CDS 100% 13.200 18.480 N Enpep n/a
3 TRCN0000031092 GCTCGGTTACACATGGAATAT pLKO.1 1966 CDS 100% 13.200 18.480 N Enpep n/a
4 TRCN0000295303 TTCGACGGTGCTTCGAGTATA pLKO_005 714 CDS 100% 13.200 18.480 N Enpep n/a
5 TRCN0000031090 CCCATGATAGAGACGTACTTT pLKO.1 2381 CDS 100% 5.625 7.875 N Enpep n/a
6 TRCN0000287795 CCCATGATAGAGACGTACTTT pLKO_005 2381 CDS 100% 5.625 7.875 N Enpep n/a
7 TRCN0000031093 GCACTTTCTAATATGCCAGAA pLKO.1 1007 CDS 100% 4.050 3.240 N Enpep n/a
8 TRCN0000287798 GCACTTTCTAATATGCCAGAA pLKO_005 1007 CDS 100% 4.050 3.240 N Enpep n/a
9 TRCN0000031089 GCAGGGTGTATTGCCATCTTA pLKO.1 3529 3UTR 100% 5.625 3.938 N Enpep n/a
10 TRCN0000287868 GCAGGGTGTATTGCCATCTTA pLKO_005 3529 3UTR 100% 5.625 3.938 N Enpep n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.