Transcript: Mouse NM_007974.4

Mus musculus coagulation factor II (thrombin) receptor-like 1 (F2rl1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
F2rl1 (14063)
Length:
2773
CDS:
114..1313

Additional Resources:

NCBI RefSeq record:
NM_007974.4
NBCI Gene record:
F2rl1 (14063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007974.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221776 GCACTGTGAATCGCATGCAAA pLKO.1 1213 CDS 100% 4.950 6.930 N F2rl1 n/a
2 TRCN0000221777 GCTCCTACTCTTCAAGCTCAA pLKO.1 1270 CDS 100% 4.050 3.240 N F2rl1 n/a
3 TRCN0000221779 CGTAGTGCATTATTTCCTAAT pLKO.1 1040 CDS 100% 10.800 7.560 N F2rl1 n/a
4 TRCN0000221775 GCCAACTACAAATACTGCTTA pLKO.1 2295 3UTR 100% 4.950 3.465 N F2rl1 n/a
5 TRCN0000221778 CATGGCAACAACTGGGTCTAT pLKO.1 528 CDS 100% 4.950 3.465 N F2rl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007974.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.