Transcript: Mouse NM_007983.2

Mus musculus Fas-associated factor 1 (Faf1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Faf1 (14084)
Length:
4452
CDS:
402..2351

Additional Resources:

NCBI RefSeq record:
NM_007983.2
NBCI Gene record:
Faf1 (14084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216885 GGAAGACAGTACGGTCTTAAA pLKO.1 848 CDS 100% 1.320 1.848 N Faf1 n/a
2 TRCN0000277492 TTATCCCTGCCATCGATTAAC pLKO_005 1169 CDS 100% 13.200 10.560 N Faf1 n/a
3 TRCN0000277494 ATTTCCCATCCATGAGTATAT pLKO_005 2516 3UTR 100% 13.200 9.240 N Faf1 n/a
4 TRCN0000217112 CTTATCCCTGCCATCGATTAA pLKO.1 1168 CDS 100% 13.200 9.240 N Faf1 n/a
5 TRCN0000200927 CCTCTGCCTTTACCTTTCTAT pLKO.1 2739 3UTR 100% 5.625 3.938 N Faf1 n/a
6 TRCN0000191814 GAAATGTGTATGACCTTACAA pLKO.1 1063 CDS 100% 5.625 3.938 N Faf1 n/a
7 TRCN0000277490 GAAATGTGTATGACCTTACAA pLKO_005 1063 CDS 100% 5.625 3.938 N Faf1 n/a
8 TRCN0000191433 CACAAACTATTCGGACTCAAA pLKO.1 1708 CDS 100% 4.950 3.465 N Faf1 n/a
9 TRCN0000277564 CACAAACTATTCGGACTCAAA pLKO_005 1708 CDS 100% 4.950 3.465 N Faf1 n/a
10 TRCN0000192222 CCCAAGAAAGTTCACCTGTTT pLKO.1 3933 3UTR 100% 4.950 3.465 N Faf1 n/a
11 TRCN0000200511 CGATCATCTAATGAAGTGTTA pLKO.1 1770 CDS 100% 4.950 3.465 N Faf1 n/a
12 TRCN0000190097 GCAGTACCGTTCAAGAGGTAA pLKO.1 1039 CDS 100% 4.950 3.465 N Faf1 n/a
13 TRCN0000277491 GCAGTACCGTTCAAGAGGTAA pLKO_005 1039 CDS 100% 4.950 3.465 N Faf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.