Transcript: Mouse NM_007992.2

Mus musculus fibulin 2 (Fbln2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Fbln2 (14115)
Length:
4477
CDS:
151..3816

Additional Resources:

NCBI RefSeq record:
NM_007992.2
NBCI Gene record:
Fbln2 (14115)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363969 ACGCACTACCAGCTCAATTTC pLKO_005 3520 CDS 100% 13.200 18.480 N Fbln2 n/a
2 TRCN0000364013 TTGATTGTCCACCCAACTATG pLKO_005 3422 CDS 100% 10.800 15.120 N Fbln2 n/a
3 TRCN0000109478 CGATTGTAGCTGGAAACAGTT pLKO.1 2304 CDS 100% 4.950 6.930 N Fbln2 n/a
4 TRCN0000348134 ACGCTGGTGGTGAGCTCATTT pLKO_005 638 CDS 100% 13.200 9.240 N Fbln2 n/a
5 TRCN0000379094 GCTGTGTGCAGAGGGCTATAT pLKO_005 2370 CDS 100% 13.200 9.240 N Fbln2 n/a
6 TRCN0000348133 ATGCCCAGAGCAAGGGTATAC pLKO_005 3285 CDS 100% 10.800 7.560 N Fbln2 n/a
7 TRCN0000374572 TCCACAGTGGCCGTAAGTATG pLKO_005 566 CDS 100% 10.800 7.560 N Fbln2 n/a
8 TRCN0000109476 GCCAACATCTATGGCTCCTAT pLKO.1 3130 CDS 100% 4.950 3.465 N Fbln2 n/a
9 TRCN0000109479 CCCAACTGCATTGAAGCTGTA pLKO.1 502 CDS 100% 4.050 2.835 N Fbln2 n/a
10 TRCN0000109477 CCAGAGTGACATCTGTAGGAT pLKO.1 1521 CDS 100% 3.000 2.100 N Fbln2 n/a
11 TRCN0000109475 GCATGGTAGCACAGACCTTTA pLKO.1 4135 3UTR 100% 10.800 6.480 N Fbln2 n/a
12 TRCN0000334143 GCATGGTAGCACAGACCTTTA pLKO_005 4135 3UTR 100% 10.800 6.480 N Fbln2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.