Transcript: Mouse NM_008006.2

Mus musculus fibroblast growth factor 2 (Fgf2), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Fgf2 (14173)
Length:
695
CDS:
198..662

Additional Resources:

NCBI RefSeq record:
NM_008006.2
NBCI Gene record:
Fgf2 (14173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067286 CGGTACCTTGCTATGAAGGAA pLKO.1 435 CDS 100% 0.000 0.000 N Fgf2 n/a
2 TRCN0000355839 GAAACGAACTGGGCAGTATAA pLKO_005 575 CDS 100% 13.200 10.560 N FGF2 n/a
3 TRCN0000067287 GAGAGGAGTTGTGTCTATCAA pLKO.1 398 CDS 100% 5.625 3.938 N Fgf2 n/a
4 TRCN0000067283 GCTTCTAAGTGTGTTACAGAA pLKO.1 471 CDS 100% 4.950 3.465 N Fgf2 n/a
5 TRCN0000067284 CACGTCAAACTACAACTCCAA pLKO.1 369 CDS 100% 2.640 1.848 N Fgf2 n/a
6 TRCN0000067285 GAAGAGTGTTTCTTCTTTGAA pLKO.1 489 CDS 100% 0.563 0.394 N Fgf2 n/a
7 TRCN0000003329 ACTACAATACTTACCGGTCAA pLKO.1 526 CDS 100% 4.050 2.835 N FGF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.