Transcript: Mouse NM_008007.2

Mus musculus fibroblast growth factor 3 (Fgf3), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fgf3 (14174)
Length:
1210
CDS:
97..834

Additional Resources:

NCBI RefSeq record:
NM_008007.2
NBCI Gene record:
Fgf3 (14174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042665 CCTTGGTACGTGTCGGTGAAT pLKO.1 550 CDS 100% 4.950 6.930 N Fgf3 n/a
2 TRCN0000042663 GCTGTATGCTTCGGATCACTA pLKO.1 408 CDS 100% 4.950 6.930 N Fgf3 n/a
3 TRCN0000042667 GAGCTGGGCTACAATACATAT pLKO.1 463 CDS 100% 13.200 10.560 N Fgf3 n/a
4 TRCN0000042666 CGCCTATAGCATCCTGGAGAT pLKO.1 309 CDS 100% 4.050 2.835 N Fgf3 n/a
5 TRCN0000042664 GCAGAGTGTGAGTTTGTGGAA pLKO.1 433 CDS 100% 2.640 1.848 N Fgf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.