Transcript: Mouse NM_008030.2

Mus musculus flavin containing monooxygenase 3 (Fmo3), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Fmo3 (14262)
Length:
2048
CDS:
65..1669

Additional Resources:

NCBI RefSeq record:
NM_008030.2
NBCI Gene record:
Fmo3 (14262)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076372 TCCAGACAGATTACATTGTTT pLKO.1 1341 CDS 100% 5.625 7.875 N Fmo3 n/a
2 TRCN0000076369 CCAGACAGATTACATTGTTTA pLKO.1 1342 CDS 100% 13.200 9.240 N Fmo3 n/a
3 TRCN0000076370 GCCTTCTGTAAACGACATGAT pLKO.1 1261 CDS 100% 4.950 3.465 N Fmo3 n/a
4 TRCN0000076371 GCAGATGAATGCCAGATTCAA pLKO.1 838 CDS 100% 0.563 0.394 N Fmo3 n/a
5 TRCN0000076368 CCAGACAAGAACTTTGCTATT pLKO.1 1711 3UTR 100% 10.800 6.480 N Fmo3 n/a
6 TRCN0000430445 TTCCACAGCAGGGACTATAAA pLKO_005 575 CDS 100% 15.000 10.500 N FMO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.