Transcript: Mouse NM_008052.3

Mus musculus deltex 1, E3 ubiquitin ligase (Dtx1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dtx1 (14357)
Length:
3715
CDS:
848..2731

Additional Resources:

NCBI RefSeq record:
NM_008052.3
NBCI Gene record:
Dtx1 (14357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037390 TCATCTTCACTATCGGAACAT pLKO.1 2544 CDS 100% 4.950 6.930 N Dtx1 n/a
2 TRCN0000037393 CGACGCCAGCTACCTAGACAA pLKO.1 2656 CDS 100% 1.650 2.310 N Dtx1 n/a
3 TRCN0000340309 ACTGCTACCTACCCAACAATG pLKO_005 2472 CDS 100% 10.800 7.560 N Dtx1 n/a
4 TRCN0000340310 TGATGAGGACTGTACCATTTG pLKO_005 2089 CDS 100% 10.800 7.560 N Dtx1 n/a
5 TRCN0000340313 TGTGCCACCACATCGAGAATG pLKO_005 978 CDS 100% 10.800 7.560 N Dtx1 n/a
6 TRCN0000340312 TTCACCACAAGACGGAGTTTG pLKO_005 2607 CDS 100% 10.800 7.560 N Dtx1 n/a
7 TRCN0000340311 CTTGAGTCAAGCACGGGATAG pLKO_005 3142 3UTR 100% 6.000 4.200 N Dtx1 n/a
8 TRCN0000037392 TGCCGCAAGACCAAGAAGAAA pLKO.1 2000 CDS 100% 5.625 3.938 N Dtx1 n/a
9 TRCN0000037389 GAAGATGGAGTTTCACCTCAT pLKO.1 2323 CDS 100% 4.050 2.835 N Dtx1 n/a
10 TRCN0000420395 TGTACTCCAATGGCAACAAGG pLKO_005 2235 CDS 100% 4.050 2.835 N DTX1 n/a
11 TRCN0000037391 CTACGACATGGACATCTGCAT pLKO.1 1207 CDS 100% 2.640 1.848 N Dtx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.