Transcript: Mouse NM_008081.3

Mus musculus beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4galnt2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
B4galnt2 (14422)
Length:
4086
CDS:
42..1574

Additional Resources:

NCBI RefSeq record:
NM_008081.3
NBCI Gene record:
B4galnt2 (14422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008081.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093661 GCCCACGGAGAGTTCTTTATT pLKO.1 1359 CDS 100% 15.000 21.000 N B4galnt2 n/a
2 TRCN0000093662 CCTGGAAATTAATGATGACTA pLKO.1 956 CDS 100% 4.950 3.960 N B4galnt2 n/a
3 TRCN0000093663 TGTTGCGTTTATGGTGAGAAA pLKO.1 122 CDS 100% 4.950 3.960 N B4galnt2 n/a
4 TRCN0000093659 GCTGCCTTGGAGAAGACTTAT pLKO.1 1467 CDS 100% 13.200 9.240 N B4galnt2 n/a
5 TRCN0000093660 CCTCAAGACATTTGTCCTCAT pLKO.1 86 CDS 100% 4.050 2.835 N B4galnt2 n/a
6 TRCN0000029869 CGGCCCAAAGATTTATTTATT pLKO.1 3053 3UTR 100% 15.000 7.500 Y Ptp4a3 n/a
7 TRCN0000319973 CGGCCCAAAGATTTATTTATT pLKO_005 3053 3UTR 100% 15.000 7.500 Y Ptp4a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008081.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.