Transcript: Mouse NM_008096.2

Mus musculus group specific component (Gc), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gc (14473)
Length:
1812
CDS:
181..1611

Additional Resources:

NCBI RefSeq record:
NM_008096.2
NBCI Gene record:
Gc (14473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105514 ACCACTTCAATTGCCAGCTAT pLKO.1 1137 CDS 100% 4.950 3.465 N Gc n/a
2 TRCN0000325781 ACCACTTCAATTGCCAGCTAT pLKO_005 1137 CDS 100% 4.950 3.465 N Gc n/a
3 TRCN0000105513 CCAGAAGTGTTCCTCAGCAAA pLKO.1 1249 CDS 100% 4.950 3.465 N Gc n/a
4 TRCN0000325713 CCAGAAGTGTTCCTCAGCAAA pLKO_005 1249 CDS 100% 4.950 3.465 N Gc n/a
5 TRCN0000105511 GCCGAGACTATGAGAAGGATA pLKO.1 239 CDS 100% 4.950 3.465 N Gc n/a
6 TRCN0000325729 GCCGAGACTATGAGAAGGATA pLKO_005 239 CDS 100% 4.950 3.465 N Gc n/a
7 TRCN0000105512 GCTCACAGATTGATGCAGAAA pLKO.1 1568 CDS 100% 4.950 3.465 N Gc n/a
8 TRCN0000325779 GCTCACAGATTGATGCAGAAA pLKO_005 1568 CDS 100% 4.950 3.465 N Gc n/a
9 TRCN0000105510 TGCACTAGCTTGGATCTTGAA pLKO.1 1622 3UTR 100% 4.950 3.465 N Gc n/a
10 TRCN0000325711 TGCACTAGCTTGGATCTTGAA pLKO_005 1622 3UTR 100% 4.950 3.465 N Gc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.