Transcript: Mouse NM_008153.3

Mus musculus chemokine-like receptor 1 (Cmklr1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Cmklr1 (14747)
Length:
2845
CDS:
262..1377

Additional Resources:

NCBI RefSeq record:
NM_008153.3
NBCI Gene record:
Cmklr1 (14747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027859 CGACTTCCTGTTCAACATCTT pLKO.1 507 CDS 100% 4.950 6.930 N Cmklr1 n/a
2 TRCN0000027923 GCCAACATTCATGGGAAGATA pLKO.1 796 CDS 100% 5.625 4.500 N Cmklr1 n/a
3 TRCN0000027931 CGTCTTTGAATGAGAAGGCTT pLKO.1 1325 CDS 100% 2.640 1.848 N Cmklr1 n/a
4 TRCN0000027892 CTTTGGCTACTTTGTGGACTT pLKO.1 318 CDS 100% 4.050 2.430 N Cmklr1 n/a
5 TRCN0000027890 GCAAGTAGTTTCCACAGGGTA pLKO.1 876 CDS 100% 2.640 1.584 N Cmklr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.