Transcript: Mouse NM_008155.4

Mus musculus glucose phosphate isomerase 1 (Gpi1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Gpi1 (14751)
Length:
2887
CDS:
124..1800

Additional Resources:

NCBI RefSeq record:
NM_008155.4
NBCI Gene record:
Gpi1 (14751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008155.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111859 CAAATCCATCACGGACATCAT pLKO.1 561 CDS 100% 4.950 6.930 N Gpi1 n/a
2 TRCN0000312319 CAAATCCATCACGGACATCAT pLKO_005 561 CDS 100% 4.950 6.930 N Gpi1 n/a
3 TRCN0000111856 CCTGAGACTTCCCTCTTTATA pLKO.1 724 CDS 100% 15.000 10.500 N Gpi1 n/a
4 TRCN0000111855 CCGTGTCCCTTCTCACCATAT pLKO.1 1830 3UTR 100% 10.800 7.560 N Gpi1 n/a
5 TRCN0000312382 CCGTGTCCCTTCTCACCATAT pLKO_005 1830 3UTR 100% 10.800 7.560 N Gpi1 n/a
6 TRCN0000111857 GTCTGGTTTGTCTCTAACATT pLKO.1 664 CDS 100% 5.625 3.938 N Gpi1 n/a
7 TRCN0000349500 GTCTGGTTTGTCTCTAACATT pLKO_005 664 CDS 100% 5.625 3.938 N Gpi1 n/a
8 TRCN0000111858 CCCTGAGACTTCCCTCTTTAT pLKO.1 723 CDS 100% 13.200 7.920 N Gpi1 n/a
9 TRCN0000312381 CCCTGAGACTTCCCTCTTTAT pLKO_005 723 CDS 100% 13.200 7.920 N Gpi1 n/a
10 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2564 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008155.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.