Transcript: Mouse NM_008181.3

Mus musculus glutathione S-transferase, alpha 1 (Ya) (Gsta1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gsta1 (14857)
Length:
861
CDS:
85..756

Additional Resources:

NCBI RefSeq record:
NM_008181.3
NBCI Gene record:
Gsta1 (14857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366334 GAGTTTGAAGAGAAGTTTATA pLKO_005 169 CDS 100% 15.000 7.500 Y Gsta1 n/a
2 TRCN0000366283 ACATGTATTCAGAAGGTATTT pLKO_005 362 CDS 100% 13.200 6.600 Y Gsta1 n/a
3 TRCN0000284673 ACTACATCGCCACCAAATATG pLKO_005 302 CDS 100% 13.200 6.600 Y Gm10639 n/a
4 TRCN0000366335 ATGATTGGGCAATTGGTATTA pLKO_005 397 CDS 100% 13.200 6.600 Y Gsta1 n/a
5 TRCN0000272226 GAGCCCTGATTGACATGTATT pLKO_005 350 CDS 100% 13.200 6.600 Y Gm10639 n/a
6 TRCN0000272253 GGAGTTTGAAGAGAAGTTTAT pLKO_005 168 CDS 100% 13.200 6.600 Y Gm10639 n/a
7 TRCN0000366332 CCACCAAATATGACCTCTATG pLKO_005 311 CDS 100% 10.800 5.400 Y Gsta1 n/a
8 TRCN0000103299 GACTGAAATGATTGGGCAATT pLKO.1 390 CDS 100% 10.800 5.400 Y Gsta2 n/a
9 TRCN0000281881 TCCTCTATGTTGAAGAGTTTG pLKO_005 575 CDS 100% 10.800 5.400 Y Gm10639 n/a
10 TRCN0000374974 ACCGTTACTTGCCTGCCTTTG pLKO_005 473 CDS 100% 6.000 3.000 Y Gsta1 n/a
11 TRCN0000103298 GTGGAGTTTGAAGAGAAGTTT pLKO.1 166 CDS 100% 5.625 2.813 Y Gsta2 n/a
12 TRCN0000374912 AGAGTCCGGAAGATTTGGAAA pLKO_005 191 CDS 100% 4.950 2.475 Y Gsta1 n/a
13 TRCN0000438316 CCAGAGCCATTCTCAACTACA pLKO_005 287 CDS 100% 4.950 2.475 Y Gsta2 n/a
14 TRCN0000103311 CTCAACTACATCGCCACCAAA pLKO.1 298 CDS 100% 4.950 2.475 Y Gsta1 n/a
15 TRCN0000103310 CTCCTCTATGTTGAAGAGTTT pLKO.1 574 CDS 100% 4.950 2.475 Y Gsta1 n/a
16 TRCN0000425818 CTCTGCTGAAGGCCTTCAAGA pLKO_005 620 CDS 100% 4.950 2.475 Y Gsta2 n/a
17 TRCN0000374975 GATGGGAATTTGATGTTTGAC pLKO_005 223 CDS 100% 4.950 2.475 Y Gsta1 n/a
18 TRCN0000103295 GCCACCAAATATGACCTCTAT pLKO.1 310 CDS 100% 4.950 2.475 Y Gsta2 n/a
19 TRCN0000439440 GTTGAAGAGCCATGGACAAGA pLKO_005 501 CDS 100% 4.950 2.475 Y Gsta2 n/a
20 TRCN0000437959 TACAGAGTCCGGAAGATTTGG pLKO_005 188 CDS 100% 4.950 2.475 Y Gsta2 n/a
21 TRCN0000376777 TGCCCATGGTGGAGATTGATG pLKO_005 248 CDS 100% 4.950 2.475 Y Gsta1 n/a
22 TRCN0000374913 AGACTACCTTGTGGGCAACAG pLKO_005 519 CDS 100% 4.050 2.025 Y Gsta1 n/a
23 TRCN0000427456 AGAGAAAGCCTCCCATGGATG pLKO_005 692 CDS 100% 4.050 2.025 Y GSTA5 n/a
24 TRCN0000103312 TCAAGAAGCAAGGAAGGCTTT pLKO.1 723 CDS 100% 4.050 2.025 Y Gsta1 n/a
25 TRCN0000103297 CCCAATGTGAAGAAGTTCCTA pLKO.1 658 CDS 100% 3.000 1.500 Y Gsta2 n/a
26 TRCN0000103314 CCCAGACCAAAGAGAAGCCAA pLKO.1 423 CDS 100% 2.640 1.320 Y Gsta1 n/a
27 TRCN0000103313 GAAGAGTTTGATGCCAGCCTT pLKO.1 586 CDS 100% 2.640 1.320 Y Gsta1 n/a
28 TRCN0000123276 CATGGACAAGACTACCTTGTT pLKO.1 511 CDS 100% 0.495 0.248 Y GSTA3 n/a
29 TRCN0000160709 CATGGACAAGACTACCTTGTT pLKO.1 511 CDS 100% 0.495 0.248 Y GSTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.