Transcript: Mouse NM_008196.1

Mus musculus granzyme K (Gzmk), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gzmk (14945)
Length:
792
CDS:
1..792

Additional Resources:

NCBI RefSeq record:
NM_008196.1
NBCI Gene record:
Gzmk (14945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032867 GCCGCATTCCAGGCCATTTAT pLKO.1 99 CDS 100% 15.000 21.000 N Gzmk n/a
2 TRCN0000429659 TAGTCTCTCAGGGCTATAAAT pLKO_005 677 CDS 100% 15.000 12.000 N Gzmk n/a
3 TRCN0000430779 AGTGTTTCCATACTGAAATTA pLKO_005 59 CDS 100% 15.000 10.500 N Gzmk n/a
4 TRCN0000032866 CCCATGAAGCAGACATTTGAA pLKO.1 271 CDS 100% 5.625 3.938 N Gzmk n/a
5 TRCN0000032865 CCCTGAGAGAAGTCACTGTTA pLKO.1 497 CDS 100% 4.950 3.465 N Gzmk n/a
6 TRCN0000032864 CCAAAGCTACTACAACCACAA pLKO.1 546 CDS 100% 4.050 2.835 N Gzmk n/a
7 TRCN0000442216 TGATCTGCAAAGGCATCTTCC pLKO_005 650 CDS 100% 4.050 2.835 N Gzmk n/a
8 TRCN0000032868 GAACTAAACAAGAATGTCCAA pLKO.1 376 CDS 100% 2.640 1.848 N Gzmk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.