Transcript: Mouse NM_008229.2

Mus musculus histone deacetylase 2 (Hdac2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hdac2 (15182)
Length:
2004
CDS:
209..1675

Additional Resources:

NCBI RefSeq record:
NM_008229.2
NBCI Gene record:
Hdac2 (15182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039395 CCCAATGAGTTGCCATATAAT pLKO.1 1184 CDS 100% 15.000 21.000 N Hdac2 n/a
2 TRCN0000375947 GACGATTCTGGGATAAGAAAC pLKO_005 1712 3UTR 100% 10.800 15.120 N Hdac2 n/a
3 TRCN0000348918 TGGTGATATTGGCAATTATTA pLKO_005 259 CDS 100% 15.000 19.500 N Hdac2 n/a
4 TRCN0000039398 CGATCAATAAGACCAGATAAT pLKO.1 440 CDS 100% 13.200 10.560 N Hdac2 n/a
5 TRCN0000348854 GGTATAGATGATGAATCATAT pLKO_005 902 CDS 100% 13.200 9.240 N Hdac2 n/a
6 TRCN0000039397 CGAGCATCAGACAAACGGATA pLKO.1 1433 CDS 100% 4.050 2.835 N Hdac2 n/a
7 TRCN0000039396 GCTGTGAAATTAAACCGGCAA pLKO.1 572 CDS 100% 2.160 1.512 N Hdac2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.