Transcript: Mouse NM_008280.2

Mus musculus lipase, hepatic (Lipc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Lipc (15450)
Length:
1934
CDS:
249..1781

Additional Resources:

NCBI RefSeq record:
NM_008280.2
NBCI Gene record:
Lipc (15450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201927 CGAGTTGATCCTGCTCAAGTT pLKO.1 1484 CDS 100% 4.950 6.930 N Lipc n/a
2 TRCN0000202462 GAAGATAGTGAGTGCGCTGAA pLKO.1 554 CDS 100% 4.050 5.670 N Lipc n/a
3 TRCN0000426150 CATTGCAGAGCATGGCTTAAA pLKO_005 1037 CDS 100% 13.200 9.240 N Lipc n/a
4 TRCN0000200470 CGAAGGAATTACCAGCAATAA pLKO.1 1424 CDS 100% 13.200 9.240 N Lipc n/a
5 TRCN0000441500 GTTGCAACACTCTGGGTTATG pLKO_005 1210 CDS 100% 10.800 7.560 N Lipc n/a
6 TRCN0000190012 GAGTCAAGAGACCCATGCAAA pLKO.1 1754 CDS 100% 4.950 3.465 N Lipc n/a
7 TRCN0000202315 GCATACCAGCACTACACCATT pLKO.1 627 CDS 100% 4.950 3.465 N Lipc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008280.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.