Transcript: Mouse NM_008290.2

Mus musculus hydroxysteroid (17-beta) dehydrogenase 2 (Hsd17b2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Hsd17b2 (15486)
Length:
1280
CDS:
51..1196

Additional Resources:

NCBI RefSeq record:
NM_008290.2
NBCI Gene record:
Hsd17b2 (15486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041599 CGGTTCCACTTCAAATGACAT pLKO.1 721 CDS 100% 4.950 3.960 N Hsd17b2 n/a
2 TRCN0000041602 GTTAAAGTTGTGACCATCAAA pLKO.1 816 CDS 100% 5.625 3.938 N Hsd17b2 n/a
3 TRCN0000041600 CCATACACAGAAGCTCATCAT pLKO.1 953 CDS 100% 4.950 3.465 N Hsd17b2 n/a
4 TRCN0000041601 CAAGACTTGTTACCTGTGGAT pLKO.1 276 CDS 100% 2.640 1.848 N Hsd17b2 n/a
5 TRCN0000041598 GCCTCTACTTAGAAAGTCCAA pLKO.1 665 CDS 100% 2.640 1.848 N Hsd17b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.