Transcript: Mouse NM_008291.3

Mus musculus hydroxysteroid (17-beta) dehydrogenase 3 (Hsd17b3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Hsd17b3 (15487)
Length:
1286
CDS:
74..991

Additional Resources:

NCBI RefSeq record:
NM_008291.3
NBCI Gene record:
Hsd17b3 (15487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000453404 AGACATCTATGACCATATTAA pLKO_005 391 CDS 100% 15.000 21.000 N Hsd17b3 n/a
2 TRCN0000041617 GCATCGGGAAAGCCTATTCAT pLKO.1 237 CDS 100% 5.625 7.875 N Hsd17b3 n/a
3 TRCN0000041613 GCCGATGAGTTTGTTAAAGAA pLKO.1 800 CDS 100% 5.625 7.875 N Hsd17b3 n/a
4 TRCN0000041616 CCTAAATAACAAGATGACCAA pLKO.1 775 CDS 100% 2.640 3.696 N Hsd17b3 n/a
5 TRCN0000041614 CCTGACACGATACTCAGATTA pLKO.1 943 CDS 100% 13.200 10.560 N Hsd17b3 n/a
6 TRCN0000446785 GACTCAATGTTGTACTTATTA pLKO_005 276 CDS 100% 15.000 10.500 N Hsd17b3 n/a
7 TRCN0000041615 CCAGAATCTCATCCACTGCAA pLKO.1 511 CDS 100% 2.640 1.848 N Hsd17b3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.