Transcript: Mouse NM_008304.2

Mus musculus syndecan 2 (Sdc2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sdc2 (15529)
Length:
3313
CDS:
524..1132

Additional Resources:

NCBI RefSeq record:
NM_008304.2
NBCI Gene record:
Sdc2 (15529)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377084 CCCATTTAGTGTCTCTATTTA pLKO_005 1137 3UTR 100% 15.000 21.000 N Sdc2 n/a
2 TRCN0000312853 TGTAGCTGTCATGGTGCAATT pLKO_005 1584 3UTR 100% 10.800 15.120 N Sdc2 n/a
3 TRCN0000344280 TGTAGCTGTCATGGTGCAATT pLKO_005 1584 3UTR 100% 10.800 15.120 N SDC2 n/a
4 TRCN0000071566 GACATCCGATAAGGATATGTA pLKO.1 595 CDS 100% 5.625 7.875 N Sdc2 n/a
5 TRCN0000071567 CACGGAGAAACATTCAGACAA pLKO.1 919 CDS 100% 4.950 6.930 N Sdc2 n/a
6 TRCN0000349353 CACGGAGAAACATTCAGACAA pLKO_005 919 CDS 100% 4.950 6.930 N Sdc2 n/a
7 TRCN0000071564 CAAAGTGGAAACCATGACGTT pLKO.1 778 CDS 100% 2.640 3.696 N Sdc2 n/a
8 TRCN0000071565 TGCGGAAGAAAGATGAAGGAA pLKO.1 1038 CDS 100% 3.000 2.400 N Sdc2 n/a
9 TRCN0000312805 GAAGCTGGGCCCTGCTATAAA pLKO_005 883 CDS 100% 15.000 10.500 N Sdc2 n/a
10 TRCN0000071563 GCTTCAGGAGTATATCCTATT pLKO.1 641 CDS 100% 10.800 7.560 N Sdc2 n/a
11 TRCN0000311814 GCTTCAGGAGTATATCCTATT pLKO_005 641 CDS 100% 10.800 7.560 N Sdc2 n/a
12 TRCN0000377150 TCGGCTTTCTCTTTGCCATTT pLKO_005 990 CDS 100% 10.800 7.560 N Sdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.