Transcript: Mouse NM_008319.2

Mus musculus intercellular adhesion molecule 5, telencephalin (Icam5), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Mus musculus (mouse)
Gene:
Icam5 (15898)
Length:
2982
CDS:
93..2846

Additional Resources:

NCBI RefSeq record:
NM_008319.2
NBCI Gene record:
Icam5 (15898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066076 GCGTGGACTCATCCGAACTTT pLKO.1 422 CDS 100% 5.625 3.938 N Icam5 n/a
2 TRCN0000066073 GCTCCAGTTAAATGTTACAAA pLKO.1 1193 CDS 100% 5.625 3.938 N Icam5 n/a
3 TRCN0000066074 GCTGCCCAGAACATATTACTT pLKO.1 1582 CDS 100% 5.625 3.938 N Icam5 n/a
4 TRCN0000066075 CCTCAAACTCTGGTCCTAGAA pLKO.1 1960 CDS 100% 4.950 3.465 N Icam5 n/a
5 TRCN0000066077 CGGTGGAATATGGTCCCAGTT pLKO.1 1792 CDS 100% 4.050 2.835 N Icam5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.