Transcript: Mouse NM_008381.4

Mus musculus inhibin beta-B (Inhbb), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Inhbb (16324)
Length:
4279
CDS:
1163..2398

Additional Resources:

NCBI RefSeq record:
NM_008381.4
NBCI Gene record:
Inhbb (16324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008381.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055253 CCAGTGTTTCAGGGTATAAAT pLKO.1 3989 3UTR 100% 15.000 10.500 N Inhbb n/a
2 TRCN0000055256 GCCTGTACTTCTTCGTCTCTA pLKO.1 1647 CDS 100% 4.950 3.465 N Inhbb n/a
3 TRCN0000055257 GTCAAGGTGTACTTCCAAGAA pLKO.1 1769 CDS 100% 4.950 3.465 N Inhbb n/a
4 TRCN0000055254 GCAACAGTTCTTCATCGACTT pLKO.1 2089 CDS 100% 4.050 2.835 N Inhbb n/a
5 TRCN0000055255 GCTCTACTTTGATGACGAGTA pLKO.1 2320 CDS 100% 4.050 2.835 N Inhbb n/a
6 TRCN0000378751 GCTGGAACGACTGGATCATAG pLKO_005 2121 CDS 100% 10.800 6.480 N INHBB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008381.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.