Transcript: Mouse NM_008399.2

Mus musculus integrin alpha E, epithelial-associated (Itgae), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Itgae (16407)
Length:
3836
CDS:
24..3527

Additional Resources:

NCBI RefSeq record:
NM_008399.2
NBCI Gene record:
Itgae (16407)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439890 CCCTGTATCGATGCGCTATAT pLKO_005 226 CDS 100% 13.200 18.480 N Itgae n/a
2 TRCN0000436806 GTGTCCGGTGGGTTAGATTTC pLKO_005 1944 CDS 100% 10.800 15.120 N Itgae n/a
3 TRCN0000066406 GCCACACTAAGCAGTTACTAA pLKO.1 3217 CDS 100% 5.625 7.875 N Itgae n/a
4 TRCN0000066404 CGCAGCCTTCAATTCAGACAT pLKO.1 2862 CDS 100% 4.950 3.960 N Itgae n/a
5 TRCN0000066407 CCTTAGAGAGATGTTCCTCAA pLKO.1 2156 CDS 100% 4.050 3.240 N Itgae n/a
6 TRCN0000416492 CTTACTGATGGTGACATATTT pLKO_005 930 CDS 100% 15.000 10.500 N Itgae n/a
7 TRCN0000419169 TGCCGATCCTTGGTGAAATAT pLKO_005 3253 CDS 100% 15.000 10.500 N Itgae n/a
8 TRCN0000066405 CCACACTTTCAAGGTGACCAA pLKO.1 1094 CDS 100% 2.640 1.848 N Itgae n/a
9 TRCN0000066403 GCCCACAGTGTCTTGTGAATT pLKO.1 3666 3UTR 100% 0.000 0.000 N Itgae n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.