Transcript: Mouse NM_008481.2

Mus musculus laminin, alpha 2 (Lama2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Lama2 (16773)
Length:
9734
CDS:
147..9503

Additional Resources:

NCBI RefSeq record:
NM_008481.2
NBCI Gene record:
Lama2 (16773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425300 TAGATTATGTCGACGACATTA pLKO_005 5692 CDS 100% 13.200 18.480 N Lama2 n/a
2 TRCN0000094298 GCGTATAAGGAGGTGTACTTA pLKO.1 2043 CDS 100% 5.625 7.875 N Lama2 n/a
3 TRCN0000094295 GCGCATCAACAGAGAGGTTTA pLKO.1 231 CDS 100% 10.800 8.640 N Lama2 n/a
4 TRCN0000432949 ACAAGTCCTCAGGGCTTATTA pLKO_005 6003 CDS 100% 15.000 10.500 N Lama2 n/a
5 TRCN0000094294 CCACTCAATATCCCATCAAAT pLKO.1 2562 CDS 100% 13.200 9.240 N Lama2 n/a
6 TRCN0000094297 CCATTGTCACACGAAGATATT pLKO.1 937 CDS 100% 13.200 9.240 N Lama2 n/a
7 TRCN0000424663 GCTAGCAGAAATCTAAGTTTA pLKO_005 1212 CDS 100% 13.200 9.240 N Lama2 n/a
8 TRCN0000083855 GCTGCCTCAAAGATATTGAAA pLKO.1 7615 CDS 100% 5.625 3.375 N LAMA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.