Transcript: Mouse NM_008482.2

Mus musculus laminin B1 (Lamb1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lamb1 (16777)
Length:
5778
CDS:
128..5632

Additional Resources:

NCBI RefSeq record:
NM_008482.2
NBCI Gene record:
Lamb1 (16777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008482.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094314 CGCAGGTAGAAGTGAAATTAA pLKO.1 4065 CDS 100% 15.000 21.000 N Lamb1 n/a
2 TRCN0000309482 CGCAGGTAGAAGTGAAATTAA pLKO_005 4065 CDS 100% 15.000 21.000 N Lamb1 n/a
3 TRCN0000311301 TCGACAGAAGGAGAGGTAATA pLKO_005 869 CDS 100% 13.200 10.560 N Lamb1 n/a
4 TRCN0000094315 CCAAGGATACAGAATCTATTA pLKO.1 935 CDS 100% 13.200 9.240 N Lamb1 n/a
5 TRCN0000309473 CCAAGGATACAGAATCTATTA pLKO_005 935 CDS 100% 13.200 9.240 N Lamb1 n/a
6 TRCN0000094317 GCTCCCTCCTTAAGGACATAA pLKO.1 5577 CDS 100% 13.200 9.240 N Lamb1 n/a
7 TRCN0000305393 TCATCTGTGACTCTCGATATT pLKO_005 834 CDS 100% 13.200 9.240 N Lamb1 n/a
8 TRCN0000094318 GACCCTTATAGTCCAAGGATA pLKO.1 923 CDS 100% 4.950 3.465 N Lamb1 n/a
9 TRCN0000309408 GACCCTTATAGTCCAAGGATA pLKO_005 923 CDS 100% 4.950 3.465 N Lamb1 n/a
10 TRCN0000094316 GCTGTTTATGATATGGTGGTT pLKO.1 1052 CDS 100% 2.640 1.848 N Lamb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008482.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.