Transcript: Mouse NM_008493.3

Mus musculus leptin (Lep), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lep (16846)
Length:
3257
CDS:
60..563

Additional Resources:

NCBI RefSeq record:
NM_008493.3
NBCI Gene record:
Lep (16846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067949 GCTTTGGTCCTATCTGTCTTA pLKO.1 92 CDS 100% 4.950 3.960 N Lep n/a
2 TRCN0000058355 GTCACCAGGATCAATGACATT pLKO.1 174 CDS 100% 4.950 3.960 N LEP n/a
3 TRCN0000067950 AGTTGGATGTTAGCCCTGAAT pLKO.1 538 CDS 100% 4.950 3.465 N Lep n/a
4 TRCN0000067948 CCCAAGTATAAACATGAAGTT pLKO.1 2448 3UTR 100% 4.950 3.465 N Lep n/a
5 TRCN0000067952 GCAGGACATTCTTCAACAGTT pLKO.1 521 CDS 100% 4.950 3.465 N Lep n/a
6 TRCN0000067951 CTTATGTTCAAGCAGTGCCTA pLKO.1 109 CDS 100% 2.640 1.848 N Lep n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.