Transcript: Mouse NM_008513.3

Mus musculus low density lipoprotein receptor-related protein 5 (Lrp5), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lrp5 (16973)
Length:
5172
CDS:
123..4967

Additional Resources:

NCBI RefSeq record:
NM_008513.3
NBCI Gene record:
Lrp5 (16973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109325 CCTGACTCAATATAGCGATTA pLKO.1 2669 CDS 100% 10.800 15.120 N Lrp5 n/a
2 TRCN0000109327 CCGACCTAAAGCGAATCGAAA pLKO.1 3511 CDS 100% 4.950 6.930 N Lrp5 n/a
3 TRCN0000109326 GCCTGACTCAATATAGCGATT pLKO.1 2668 CDS 100% 4.050 5.670 N Lrp5 n/a
4 TRCN0000109329 CCCGACCTGATGGGACTCAAA pLKO.1 1875 CDS 100% 1.650 2.310 N Lrp5 n/a
5 TRCN0000109328 GCCATTGCCATTGACTACGAT pLKO.1 1242 CDS 100% 3.000 2.100 N Lrp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.