Transcript: Mouse NM_008569.2

Mus musculus anaphase promoting complex subunit 1 (Anapc1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Anapc1 (17222)
Length:
8967
CDS:
268..6102

Additional Resources:

NCBI RefSeq record:
NM_008569.2
NBCI Gene record:
Anapc1 (17222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008569.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088175 CGGGTACAGTATGTTGTAGAT pLKO.1 970 CDS 100% 4.950 6.930 N Anapc1 n/a
2 TRCN0000354143 CGGGTACAGTATGTTGTAGAT pLKO_005 970 CDS 100% 4.950 6.930 N Anapc1 n/a
3 TRCN0000088173 CCAATGGAACTCAGTTGCATA pLKO.1 6193 3UTR 100% 4.950 3.960 N Anapc1 n/a
4 TRCN0000306399 GCATAGACGGGAAGGATTATA pLKO_005 755 CDS 100% 15.000 10.500 N Anapc1 n/a
5 TRCN0000088174 GCGTTGGCTATGATCTACTTA pLKO.1 4375 CDS 100% 5.625 3.938 N Anapc1 n/a
6 TRCN0000326775 GCGTTGGCTATGATCTACTTA pLKO_005 4375 CDS 100% 5.625 3.938 N Anapc1 n/a
7 TRCN0000088176 CCTCCACGAAACACAACTGTA pLKO.1 3601 CDS 100% 4.950 3.465 N Anapc1 n/a
8 TRCN0000088177 CGCAATGTTGAGTCTCATCTT pLKO.1 2416 CDS 100% 4.950 3.465 N Anapc1 n/a
9 TRCN0000326836 CGCAATGTTGAGTCTCATCTT pLKO_005 2416 CDS 100% 4.950 3.465 N Anapc1 n/a
10 TRCN0000306459 AGGGAAACCCACCCTAGAAAT pLKO_005 6115 3UTR 100% 13.200 7.920 N Anapc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008569.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.