Transcript: Mouse NM_008585.2

Mus musculus meprin 1 alpha (Mep1a), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mep1a (17287)
Length:
2937
CDS:
17..2299

Additional Resources:

NCBI RefSeq record:
NM_008585.2
NBCI Gene record:
Mep1a (17287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442302 TAACTCAAGTGGTGGTATTTA pLKO_005 1291 CDS 100% 15.000 21.000 N Mep1a n/a
2 TRCN0000446232 GGTTTGGACCATCCGGAATAT pLKO_005 1354 CDS 100% 13.200 18.480 N Mep1a n/a
3 TRCN0000050903 CCGGGATGATTATGTGAACAT pLKO.1 565 CDS 100% 4.950 6.930 N MEP1A n/a
4 TRCN0000031310 CCAAACATCTTCAGCTATAAA pLKO.1 1654 CDS 100% 15.000 10.500 N Mep1a n/a
5 TRCN0000031311 CGGGATGATTATGTGAACATT pLKO.1 566 CDS 100% 5.625 3.938 N Mep1a n/a
6 TRCN0000031309 CCATACATTCTGGCTGACAAT pLKO.1 290 CDS 100% 4.950 3.465 N Mep1a n/a
7 TRCN0000031313 CCCTACCATTACTACCAAGAT pLKO.1 727 CDS 100% 4.950 3.465 N Mep1a n/a
8 TRCN0000031312 CGTCACATTCTCTACCACCAA pLKO.1 2260 CDS 100% 2.640 1.848 N Mep1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.