Transcript: Mouse NM_008669.4

Mus musculus N-acetyl galactosaminidase, alpha (Naga), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Naga (17939)
Length:
1913
CDS:
137..1384

Additional Resources:

NCBI RefSeq record:
NM_008669.4
NBCI Gene record:
Naga (17939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008669.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348320 GCAATCTCTGGCGCAACTATA pLKO_005 762 CDS 100% 13.200 18.480 N Naga n/a
2 TRCN0000111264 GCAGGATCTTAAAGAGCAAAT pLKO.1 1080 CDS 100% 10.800 7.560 N Naga n/a
3 TRCN0000334546 GCAGGATCTTAAAGAGCAAAT pLKO_005 1080 CDS 100% 10.800 7.560 N Naga n/a
4 TRCN0000111263 CCGAAGAACTGCATCAGTGAA pLKO.1 272 CDS 100% 4.950 3.465 N Naga n/a
5 TRCN0000334464 CCGAAGAACTGCATCAGTGAA pLKO_005 272 CDS 100% 4.950 3.465 N Naga n/a
6 TRCN0000111261 CGCAGGATCTTAAAGAGCAAA pLKO.1 1079 CDS 100% 4.950 3.465 N Naga n/a
7 TRCN0000111260 GCTGACTCAGAAATCAGGATT pLKO.1 1707 3UTR 100% 4.950 2.970 N Naga n/a
8 TRCN0000334497 GCTGACTCAGAAATCAGGATT pLKO_005 1707 3UTR 100% 4.950 2.970 N Naga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008669.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.