Transcript: Mouse NM_008730.2

Mus musculus neuronal pentraxin 1 (Nptx1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nptx1 (18164)
Length:
5284
CDS:
232..1530

Additional Resources:

NCBI RefSeq record:
NM_008730.2
NBCI Gene record:
Nptx1 (18164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176768 CGCAAATCTAATCCGCATATT pLKO.1 4030 3UTR 100% 13.200 18.480 N Nptx1 n/a
2 TRCN0000279436 CGCAAATCTAATCCGCATATT pLKO_005 4030 3UTR 100% 13.200 18.480 N Nptx1 n/a
3 TRCN0000181576 GCTGCCGTTTGTAATCAACGA pLKO.1 1137 CDS 100% 2.640 2.112 N Nptx1 n/a
4 TRCN0000279437 AGTCCCAGATCGAGATCTTTG pLKO_005 1463 CDS 100% 10.800 7.560 N Nptx1 n/a
5 TRCN0000279438 TGCGGACCAACTACATGTATG pLKO_005 932 CDS 100% 10.800 7.560 N Nptx1 n/a
6 TRCN0000181419 CAAGCATTTGTGGGTGAGCTA pLKO.1 1339 CDS 100% 2.640 1.848 N Nptx1 n/a
7 TRCN0000198283 GAGACAAGTTTCAGCTGACAT pLKO.1 905 CDS 100% 4.950 2.970 N Nptx1 n/a
8 TRCN0000279435 GAGACAAGTTTCAGCTGACAT pLKO_005 905 CDS 100% 4.950 2.970 N Nptx1 n/a
9 TRCN0000437598 AGTACAGCCGCCTCAATTCCT pLKO_005 677 CDS 100% 3.000 1.800 N NPTX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.