Transcript: Mouse NM_008734.3

Mus musculus neuregulin 3 (Nrg3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nrg3 (18183)
Length:
4012
CDS:
289..2430

Additional Resources:

NCBI RefSeq record:
NM_008734.3
NBCI Gene record:
Nrg3 (18183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065407 CTCAGCCTCATGCTGCTTAAA pLKO.1 529 CDS 100% 13.200 9.240 N Nrg3 n/a
2 TRCN0000065403 GCTGTCAATTTCATGTATCAT pLKO.1 1377 CDS 100% 5.625 3.938 N Nrg3 n/a
3 TRCN0000065404 CCAGCATATCAACAACTTGAA pLKO.1 1789 CDS 100% 4.950 3.465 N Nrg3 n/a
4 TRCN0000065406 CCAGTCAGTGATTGTCTTCTA pLKO.1 2182 CDS 100% 4.950 3.465 N Nrg3 n/a
5 TRCN0000155776 CCTATACAGCTGTGGTGTGTT pLKO.1 1882 CDS 100% 4.950 3.465 N NRG3 n/a
6 TRCN0000065405 CGAGAGGCACAATTTGTCTTA pLKO.1 2371 CDS 100% 4.950 3.465 N Nrg3 n/a
7 TRCN0000150772 GTAGGAATCTGTGCATTCTAT pLKO.1 2439 3UTR 100% 5.625 3.375 N NRG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.