Transcript: Mouse NM_008750.5

Mus musculus nucleoredoxin (Nxn), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nxn (18230)
Length:
2728
CDS:
82..1389

Additional Resources:

NCBI RefSeq record:
NM_008750.5
NBCI Gene record:
Nxn (18230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008750.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114323 CCAACATTCCATCGCTAATAT pLKO.1 470 CDS 100% 15.000 21.000 N Nxn n/a
2 TRCN0000345274 CCAACATTCCATCGCTAATAT pLKO_005 470 CDS 100% 15.000 21.000 N Nxn n/a
3 TRCN0000114321 GCCTTGTTTCTACATTAGCAA pLKO.1 1509 3UTR 100% 3.000 2.400 N Nxn n/a
4 TRCN0000345277 GCCTTGTTTCTACATTAGCAA pLKO_005 1509 3UTR 100% 3.000 2.400 N Nxn n/a
5 TRCN0000114322 GCCAAGTACGTGATGGATGTA pLKO.1 1291 CDS 100% 4.950 3.465 N Nxn n/a
6 TRCN0000353191 GCCAAGTACGTGATGGATGTA pLKO_005 1291 CDS 100% 4.950 3.465 N Nxn n/a
7 TRCN0000114324 TCTCGTCTCAACCGACTGTAT pLKO.1 871 CDS 100% 4.950 3.465 N Nxn n/a
8 TRCN0000345345 TCTCGTCTCAACCGACTGTAT pLKO_005 871 CDS 100% 4.950 3.465 N Nxn n/a
9 TRCN0000114325 GTGAATGACTTCCTAGCAGAA pLKO.1 1345 CDS 100% 4.050 2.835 N Nxn n/a
10 TRCN0000345276 GTGAATGACTTCCTAGCAGAA pLKO_005 1345 CDS 100% 4.050 2.835 N Nxn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008750.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.