Transcript: Mouse NM_008787.3

Mus musculus pericentrin (kendrin) (Pcnt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-08
Taxon:
Mus musculus (mouse)
Gene:
Pcnt (18541)
Length:
9530
CDS:
295..9045

Additional Resources:

NCBI RefSeq record:
NM_008787.3
NBCI Gene record:
Pcnt (18541)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247104 TAAAGTCCTTGCGGCTCTTAA pLKO_005 9047 3UTR 100% 13.200 18.480 N Pcnt n/a
2 TRCN0000247103 TCGAGTGGTCATCGCAGTATT pLKO_005 8637 CDS 100% 13.200 18.480 N Pcnt n/a
3 TRCN0000247105 TTCAAACCTAGGAGATTATAA pLKO_005 6654 CDS 100% 15.000 12.000 N Pcnt n/a
4 TRCN0000192573 GCTGCGTTCTTAATAGGCAAA pLKO.1 8294 CDS 100% 4.050 3.240 N Pcnt n/a
5 TRCN0000192425 CCTAAGGAAAGCCCATGATAT pLKO.1 9106 3UTR 100% 13.200 9.240 N Pcnt n/a
6 TRCN0000247101 TTGACGGAGCTTCGGGAAATG pLKO_005 742 CDS 100% 10.800 7.560 N Pcnt n/a
7 TRCN0000201630 CCGCCAGATTCTACTCAGAAA pLKO.1 8998 CDS 100% 4.950 3.465 N Pcnt n/a
8 TRCN0000247102 GGAGCACCTGAGGGTCTATTT pLKO_005 1482 CDS 100% 13.200 7.920 N Pcnt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.