Transcript: Mouse NM_008803.2

Mus musculus phosphodiesterase 8A (Pde8a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pde8a (18584)
Length:
2683
CDS:
112..2583

Additional Resources:

NCBI RefSeq record:
NM_008803.2
NBCI Gene record:
Pde8a (18584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114888 CCACAGTTTAATGCTCAGGAT pLKO.1 1387 CDS 100% 2.640 3.696 N Pde8a n/a
2 TRCN0000114890 CCTCCAGAACAAGTGACGTTT pLKO.1 1196 CDS 100% 4.950 3.960 N Pde8a n/a
3 TRCN0000114887 CCCTGCATTTGAATCAACAAT pLKO.1 822 CDS 100% 5.625 3.938 N Pde8a n/a
4 TRCN0000114889 CCTAACCTTATGCAGCACCTA pLKO.1 2491 CDS 100% 2.640 1.848 N Pde8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.