Transcript: Mouse NM_008823.4

Mus musculus complement factor properdin (Cfp), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Cfp (18636)
Length:
1636
CDS:
102..1496

Additional Resources:

NCBI RefSeq record:
NM_008823.4
NBCI Gene record:
Cfp (18636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191122 CGTCAACGAGTATGTGATAAT pLKO.1 564 CDS 100% 13.200 18.480 N Cfp n/a
2 TRCN0000190239 CCACTCGGAACCAAATGTGTA pLKO.1 988 CDS 100% 4.950 3.465 N Cfp n/a
3 TRCN0000189926 GAGAGACATCAGGGTAGAAGA pLKO.1 233 CDS 100% 4.950 3.465 N Cfp n/a
4 TRCN0000189576 CTGTCACATGCTCCAAAGGAA pLKO.1 535 CDS 100% 3.000 2.100 N Cfp n/a
5 TRCN0000201932 CCAGGATATTCGACACTGCTA pLKO.1 1178 CDS 100% 2.640 1.848 N Cfp n/a
6 TRCN0000200681 GTGAGAAGAATGTTACCTTCT pLKO.1 1360 CDS 100% 0.405 0.284 N Cfp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.