Transcript: Mouse NM_008829.2

Mus musculus progesterone receptor (Pgr), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pgr (18667)
Length:
6889
CDS:
636..3416

Additional Resources:

NCBI RefSeq record:
NM_008829.2
NBCI Gene record:
Pgr (18667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025977 CCGCGAATTGATCAAGGCAAT pLKO.1 3161 CDS 100% 4.050 5.670 N Pgr n/a
2 TRCN0000026017 CAGTAGTCAAATGGTCTAAAT pLKO.1 2797 CDS 100% 13.200 10.560 N Pgr n/a
3 TRCN0000025996 GCACCTGATCTAATCCTAAAT pLKO.1 2949 CDS 100% 13.200 10.560 N Pgr n/a
4 TRCN0000026003 GCCAGTTTGAAGAGATGAGAT pLKO.1 3130 CDS 100% 4.950 3.465 N Pgr n/a
5 TRCN0000026032 CCAAAGGAAGATTCACGGTTT pLKO.1 1443 CDS 100% 4.050 2.835 N Pgr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.