Transcript: Mouse NM_008863.4

Mus musculus protein kinase inhibitor beta, cAMP dependent, testis specific (Pkib), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pkib (18768)
Length:
5495
CDS:
408..740

Additional Resources:

NCBI RefSeq record:
NM_008863.4
NBCI Gene record:
Pkib (18768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008863.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362577 ATGATACGGAAATAGGTTATT pLKO_005 968 3UTR 100% 13.200 18.480 N Pkib n/a
2 TRCN0000362578 CCTCTGATCTTCCACTGAAAC pLKO_005 628 CDS 100% 10.800 7.560 N Pkib n/a
3 TRCN0000362645 TGGTATGTATAGACCGAAATC pLKO_005 1123 3UTR 100% 10.800 7.560 N Pkib n/a
4 TRCN0000088739 GAGGACAGATTCATCAGAGAT pLKO.1 506 CDS 100% 4.950 3.465 N Pkib n/a
5 TRCN0000088738 GCTGGGTATAAAGGGAGGATA pLKO.1 2281 3UTR 100% 4.950 3.465 N Pkib n/a
6 TRCN0000088741 TCCAGAGTTCACTGGCTACAA pLKO.1 601 CDS 100% 4.950 3.465 N Pkib n/a
7 TRCN0000088740 TCCTCTGATCTTCCACTGAAA pLKO.1 627 CDS 100% 4.950 3.465 N Pkib n/a
8 TRCN0000362576 AGAGTTCACTGGCTACAAGTG pLKO_005 604 CDS 100% 4.050 2.835 N Pkib n/a
9 TRCN0000088742 GAAGAGAAAGACCAAGGCCAA pLKO.1 690 CDS 100% 2.160 1.296 N Pkib n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008863.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.