Transcript: Mouse NM_008867.2

Mus musculus phospholipase A2 receptor 1 (Pla2r1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Mus musculus (mouse)
Gene:
Pla2r1 (18779)
Length:
7112
CDS:
179..4642

Additional Resources:

NCBI RefSeq record:
NM_008867.2
NBCI Gene record:
Pla2r1 (18779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076887 CCGGAAGGAATATGGCACTTT pLKO.1 4253 CDS 100% 4.950 6.930 N Pla2r1 n/a
2 TRCN0000076885 CGCCCAAGATTTGACTCACAT pLKO.1 253 CDS 100% 4.950 6.930 N Pla2r1 n/a
3 TRCN0000076886 CCGTGGTAATATGACTTGGTA pLKO.1 3562 CDS 100% 3.000 4.200 N Pla2r1 n/a
4 TRCN0000443091 TGCTCTGGAGCAACCATTAAA pLKO_005 475 CDS 100% 15.000 12.000 N Pla2r1 n/a
5 TRCN0000076884 CGTGGTAATATGACTTGGTAT pLKO.1 3563 CDS 100% 4.950 3.960 N Pla2r1 n/a
6 TRCN0000450177 AGCACAGCCTGCGAGTCATTT pLKO_005 3833 CDS 100% 13.200 9.240 N Pla2r1 n/a
7 TRCN0000440640 GATTGGTTTGAGTAGCAATAA pLKO_005 1498 CDS 100% 13.200 9.240 N Pla2r1 n/a
8 TRCN0000446237 TATATGCAAACGGGATCTAAA pLKO_005 1240 CDS 100% 13.200 9.240 N Pla2r1 n/a
9 TRCN0000076883 GCTCTCAACTAATACTTTGAA pLKO.1 4996 3UTR 100% 5.625 3.938 N Pla2r1 n/a
10 TRCN0000439659 ATCATGAGAAATGGGTAAATG pLKO_005 3261 CDS 100% 13.200 7.920 N Pla2r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.