Transcript: Mouse NM_008868.3

Mus musculus phospholipase A2, group IIC (Pla2g2c), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pla2g2c (18781)
Length:
1618
CDS:
353..805

Additional Resources:

NCBI RefSeq record:
NM_008868.3
NBCI Gene record:
Pla2g2c (18781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076890 CTTCTTCTCCTATTACGGATA pLKO.1 463 CDS 100% 4.050 3.240 N Pla2g2c n/a
2 TRCN0000076892 GCCTTCTTCTCCTATTACGGA pLKO.1 461 CDS 100% 0.750 0.600 N Pla2g2c n/a
3 TRCN0000076888 CTGGAAACAAACCGTGGGTAT pLKO.1 923 3UTR 100% 4.050 2.835 N Pla2g2c n/a
4 TRCN0000076889 CCTGTGAGTGTGACAAACAGT pLKO.1 684 CDS 100% 3.000 2.100 N Pla2g2c n/a
5 TRCN0000076891 CTATTACGGATATGGCTGCTA pLKO.1 472 CDS 100% 2.640 1.848 N Pla2g2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.