Transcript: Mouse NM_008880.3

Mus musculus phospholipid scramblase 2 (Plscr2), transcript variant B, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plscr2 (18828)
Length:
1895
CDS:
421..1344

Additional Resources:

NCBI RefSeq record:
NM_008880.3
NBCI Gene record:
Plscr2 (18828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008880.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363795 GGCCTTCACGGATTCGGATAA pLKO_005 1221 CDS 100% 10.800 15.120 N Plscr2 n/a
2 TRCN0000105234 CTTCACGGATTCGGATAACTT pLKO.1 1224 CDS 100% 5.625 7.875 N Plscr2 n/a
3 TRCN0000105231 CCTGGGCTAGAATACTTAAAT pLKO.1 703 CDS 100% 15.000 10.500 N Plscr2 n/a
4 TRCN0000375573 TGCACCTGCTGTTCAGATATT pLKO_005 1123 CDS 100% 13.200 9.240 N Plscr2 n/a
5 TRCN0000105230 GACGAAGAGAAGTGTATGTTT pLKO.1 1612 3UTR 100% 5.625 3.938 N Plscr2 n/a
6 TRCN0000352055 GACGAAGAGAAGTGTATGTTT pLKO_005 1612 3UTR 100% 5.625 3.938 N Plscr2 n/a
7 TRCN0000105232 GCCAAAGCTCACTCTTCAGAA pLKO.1 1056 CDS 100% 4.950 3.465 N Plscr2 n/a
8 TRCN0000352053 GCCAAAGCTCACTCTTCAGAA pLKO_005 1056 CDS 100% 4.950 3.465 N Plscr2 n/a
9 TRCN0000105233 CTTGATGAAGTGACTAGAATT pLKO.1 1162 CDS 100% 0.000 0.000 N Plscr2 n/a
10 TRCN0000352135 CTTGATGAAGTGACTAGAATT pLKO_005 1162 CDS 100% 0.000 0.000 N Plscr2 n/a
11 TRCN0000375574 CGTCTAGACCTTTCACTTTAA pLKO_005 881 CDS 100% 13.200 7.920 N Plscr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008880.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.