Transcript: Mouse NM_008887.2

Mus musculus paired-like homeobox 2a (Phox2a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Phox2a (11859)
Length:
1609
CDS:
186..1028

Additional Resources:

NCBI RefSeq record:
NM_008887.2
NBCI Gene record:
Phox2a (11859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070463 CCCAATCATAAAGGGTCCTAA pLKO.1 1315 3UTR 100% 4.950 6.930 N Phox2a n/a
2 TRCN0000417081 ATCCGCACAACGTTCACGAGT pLKO_005 462 CDS 100% 2.640 3.696 N Phox2a n/a
3 TRCN0000070467 GACATTTACACTCGCGAGGAA pLKO.1 531 CDS 100% 2.640 3.696 N Phox2a n/a
4 TRCN0000070465 CCCGCACCCTACTCGGCAGTT pLKO.1 384 CDS 100% 0.000 0.000 N Phox2a n/a
5 TRCN0000070466 CCAGCCGCTCAAGGGAGCGTT pLKO.1 845 CDS 100% 0.000 0.000 N Phox2a n/a
6 TRCN0000430275 ACTCTGGTCTGGAGTACTAAT pLKO_005 1202 3UTR 100% 13.200 9.240 N Phox2a n/a
7 TRCN0000070464 CCAGGTCCCTTCTCTGGAGTT pLKO.1 954 CDS 100% 1.350 0.945 N Phox2a n/a
8 TRCN0000013547 GCGCTCAAGATCGACCTCACT pLKO.1 555 CDS 100% 0.880 0.616 N PHOX2A n/a
9 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 592 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.