Transcript: Mouse NM_008892.2

Mus musculus polymerase (DNA directed), alpha 1 (Pola1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pola1 (18968)
Length:
5350
CDS:
45..4442

Additional Resources:

NCBI RefSeq record:
NM_008892.2
NBCI Gene record:
Pola1 (18968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071230 CCAGTTTGTATCGTTGCAGTA pLKO.1 3970 CDS 100% 4.050 5.670 N Pola1 n/a
2 TRCN0000287379 CCAGTTTGTATCGTTGCAGTA pLKO_005 3970 CDS 100% 4.050 5.670 N Pola1 n/a
3 TRCN0000071229 GCCAATCAGTTGGTGTAAATT pLKO.1 1583 CDS 100% 15.000 12.000 N Pola1 n/a
4 TRCN0000287378 GCCAATCAGTTGGTGTAAATT pLKO_005 1583 CDS 100% 15.000 12.000 N Pola1 n/a
5 TRCN0000294877 CCTAACTGCTGCACCACTATC pLKO_005 4506 3UTR 100% 10.800 8.640 N Pola1 n/a
6 TRCN0000071231 CGTCAGGATGATGACTGGATT pLKO.1 279 CDS 100% 4.950 3.960 N Pola1 n/a
7 TRCN0000294876 GACTTGACTCCACTCAATTTA pLKO_005 3775 CDS 100% 15.000 10.500 N Pola1 n/a
8 TRCN0000370110 CAGATCATGTGTGAGCTAAAT pLKO_005 2316 CDS 100% 13.200 9.240 N POLA1 n/a
9 TRCN0000071232 CCAAACTTAGAGATGGGCATT pLKO.1 2766 CDS 100% 4.050 2.835 N Pola1 n/a
10 TRCN0000071228 CCTGGATTTCAACAGTTTATA pLKO.1 2630 CDS 100% 15.000 9.000 N Pola1 n/a
11 TRCN0000287380 CCTGGATTTCAACAGTTTATA pLKO_005 2630 CDS 100% 15.000 9.000 N Pola1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.