Transcript: Mouse NM_008909.2

Mus musculus periplakin (Ppl), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ppl (19041)
Length:
6277
CDS:
139..5403

Additional Resources:

NCBI RefSeq record:
NM_008909.2
NBCI Gene record:
Ppl (19041)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090574 GCTGCTCAATATGACCGCTAT pLKO.1 5326 CDS 100% 4.050 5.670 N Ppl n/a
2 TRCN0000305396 TGGACAAGACCAGGTTAATAG pLKO_005 3899 CDS 100% 13.200 10.560 N Ppl n/a
3 TRCN0000090575 CGGCAGATTGATAAACTGCAT pLKO.1 4270 CDS 100% 2.640 2.112 N Ppl n/a
4 TRCN0000309539 CGGCAGATTGATAAACTGCAT pLKO_005 4270 CDS 100% 2.640 2.112 N Ppl n/a
5 TRCN0000090573 CCACCTCTGATGACTTAATAA pLKO.1 5646 3UTR 100% 15.000 10.500 N Ppl n/a
6 TRCN0000309538 CCACCTCTGATGACTTAATAA pLKO_005 5646 3UTR 100% 15.000 10.500 N Ppl n/a
7 TRCN0000305335 CCAAGTTCACAGAGGTTAATG pLKO_005 2663 CDS 100% 13.200 9.240 N Ppl n/a
8 TRCN0000116939 CCGCTATGTCAACAAGGATAT pLKO.1 5340 CDS 100% 10.800 7.560 N PPL n/a
9 TRCN0000090576 CCAAGTTATCTGAGCTAGAAT pLKO.1 4757 CDS 100% 5.625 3.938 N Ppl n/a
10 TRCN0000309466 CCAAGTTATCTGAGCTAGAAT pLKO_005 4757 CDS 100% 5.625 3.938 N Ppl n/a
11 TRCN0000090577 GCGGTGAAGGACTATGAACTT pLKO.1 2521 CDS 100% 4.950 3.465 N Ppl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.