Transcript: Mouse NM_008920.4

Mus musculus proteoglycan 2, bone marrow (Prg2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Prg2 (19074)
Length:
838
CDS:
53..724

Additional Resources:

NCBI RefSeq record:
NM_008920.4
NBCI Gene record:
Prg2 (19074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098723 GATGGGTTGATGGAAGTTCTT pLKO.1 573 CDS 100% 4.950 6.930 N Prg2 n/a
2 TRCN0000098721 GCGTCTATCTCACTGTGTCAA pLKO.1 676 CDS 100% 4.950 6.930 N Prg2 n/a
3 TRCN0000098724 GCCGATGCAAACGCTTTCGAT pLKO.1 555 CDS 100% 3.000 4.200 N Prg2 n/a
4 TRCN0000098720 CCACAGTTTCAGTGTTAACTT pLKO.1 463 CDS 100% 5.625 4.500 N Prg2 n/a
5 TRCN0000098722 CCCATTGATGGATGAGAACTT pLKO.1 136 CDS 100% 4.950 3.465 N Prg2 n/a
6 TRCN0000436237 AGGGTCAAGTCTGGATTGGAG pLKO_005 516 CDS 100% 2.640 1.848 N PRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.