Transcript: Mouse NM_008939.2

Mus musculus protease, serine 12 neurotrypsin (motopsin) (Prss12), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Prss12 (19142)
Length:
2607
CDS:
247..2532

Additional Resources:

NCBI RefSeq record:
NM_008939.2
NBCI Gene record:
Prss12 (19142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032090 CGGATCATTGGTGGGAACAAT pLKO.1 1792 CDS 100% 5.625 4.500 N Prss12 n/a
2 TRCN0000032092 CCAATATTGTTGGATGAAGTA pLKO.1 925 CDS 100% 4.950 3.465 N Prss12 n/a
3 TRCN0000032091 GCCTACTCAAGAACTCTACAA pLKO.1 2230 CDS 100% 4.950 3.465 N Prss12 n/a
4 TRCN0000032089 CCTTGGTGCTTCTATCGGAAT pLKO.1 661 CDS 100% 4.050 2.835 N Prss12 n/a
5 TRCN0000032093 GCAGGAGTCATCTGTGACTAT pLKO.1 1687 CDS 100% 0.495 0.347 N Prss12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.