Transcript: Mouse NM_008990.3

Mus musculus nectin cell adhesion molecule 2 (Nectin2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nectin2 (19294)
Length:
2735
CDS:
272..1864

Additional Resources:

NCBI RefSeq record:
NM_008990.3
NBCI Gene record:
Nectin2 (19294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426920 AGTATCTCAAGAACCCTTAAA pLKO_005 2176 3UTR 100% 13.200 18.480 N Nectin2 n/a
2 TRCN0000425679 CCATCCTTCGGAGTGGATTTC pLKO_005 515 CDS 100% 10.800 15.120 N Nectin2 n/a
3 TRCN0000112532 GCCATACTGACCTGTGATGTA pLKO.1 1079 CDS 100% 4.950 6.930 N Nectin2 n/a
4 TRCN0000439806 GAAGGACCTCCCTCCTATAAA pLKO_005 1445 CDS 100% 15.000 12.000 N Nectin2 n/a
5 TRCN0000112531 CGTCACTATCATCAGCCGATA pLKO.1 892 CDS 100% 4.050 3.240 N Nectin2 n/a
6 TRCN0000112533 GAAGTATCCATCTCCGGCTAT pLKO.1 1028 CDS 100% 4.050 3.240 N Nectin2 n/a
7 TRCN0000444010 CAGTGAAGACGCCATACTTTG pLKO_005 1545 CDS 100% 10.800 7.560 N Nectin2 n/a
8 TRCN0000112530 CCATGAGCTTTCCACCAGTAA pLKO.1 1907 3UTR 100% 4.950 3.465 N Nectin2 n/a
9 TRCN0000112534 CTCCTACCAGAGCAAAGACTT pLKO.1 1816 CDS 100% 4.950 3.465 N Nectin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.